Database ABeeBOL DNA Barcode
Title image Voucher specimen of Andrena yamato Tadauchi et Hirashima

Welcome to the ABeeBOL DNA Barcode Database of Asian Bees !

Japanese page is here

ABeeBOL is a DNA barcode database of Asian bees. DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. The cytochrome c oxidase subunit 1 mitochondrial region (COI) is emerging as the standard barcode region for higher animals. It is 648 nucleotide base pairs long in most groups-a very short sequence. The data of ABeeBOL contain standard DNA barcode region and other ones. In insects DNA barcode data of butterflies and mosquitoes have been accumulated. Those of bees also have been rapidly accumulated after BEEBOL, a committee promoting DNA barcoding of bees was organized by Professor Laurence Packer of York University, Canada in 2008. We will continue to accumulate Asian bee DNA barcode data.

The total number of specimens in ABeeBOL at present is 252 (January 9, 2015). Each record consists of 41 items in the format of the Darwin Core of the Global Biodiversity Information Facility (GBIF), including scientific name, country, collection locality, collection date, collector, etc. of the specimen as well as its barcode data.

The ABeeBOL is managed by a text database management system SIGMA.

The ABeeBOL file is supported by a Grant-in-Aid for Publication of Scientific Research Results (Head Investigator: Osamu Tadauchi) from the Japan Society for the Promotion of Science and by the Environment Research and Technology Development Fund (S-9-2(8)) of the Ministry of the Environment, Japan (Head Investigator: Osamu Tadauchi).

The use of data in this database is free of charge if the objective is academic study or educational purposes.




Items of Data

Data and Tags are the Following 40 items.
1.(DATE)Date Last Modified
2. (SID) DNA Sample ID
3. (ABeeBOLID)ABeeBOL ID
4. (GenBank) GenBank Accesssion No.
5. (BOLD) BOLD ID
6. (GEN) Genome
7. (LOCUS) Locus
8. (PCR) PCR Primers
9. (SEQ) Sequence
10. (IST) Institution Code
11. (COLC) Collection Code
12. (NAME) Scientific name
13. (JPNAME) Japanese name
14. (BR) Basis of Record
15. (KING) Kingdum
16. (PHY) Phylum
17. (CL) Class
18. (OR) Order
19. (FAM) Family
20. (GEN) Genus
21. (SP) Species
22. (SSP) Subspecies
23. (AU) Scientific Name Author
24. (IDENT) Identification By
25. (YIDENT) Year Identified
26. (TYPES) Type Status
27. (COL) Collector
28. (COLD) Collecting Date
29. (C) Country
30. (STATE) State Province
31. (COUNT) County
32. (LOC) Locality
33. (LON) Longitude
34. (LAT) Latitude
35. (SEX) Sex
36. (TYPE) Preparation Type
37. (RCAT) Related Catalog Item
38. (SDEP) Specimen Depository
39. (PUB) Publication
40. (NOTE) Notes
41. (IMAGE) Image


Example of a record


Date Last Modified 2013 12. 17
DNA Sample ID DNA000130
ABeeBOL ID ABeeBOL No.27
GenBank Accesssion No.  
BOLD ID  
Genome Mitochondrial
Locus COI (cytochrome c oxidase subunit I)
PCR Primers COI_pF2/COI_2437d
Sequence ATGATTAGTTCCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTCTGACTCCTT-ATT CCTTCCCTATTTATATTATTAATAAGAAGAATTCTAGCCTCTGGATCAGGAACAGGATGAACAGTATACCCCCCACTTTC TTCAATTATATACCATTCATCAATCTCAGTAGATTGCACAATTTTTTCATTACATATCGCAGGAATTTCATCAATTATAG GAGCTATTAATTTTATTGTTTCAATTATATTAATAAAAAATATTTCAATTAATTATGATCAAATTCCACTATTTCCATGA TCAGTAAAAATTACTGCTATTCTATTACTATTATCTTTACCAGTACTAGCAGGAGCTATTACAATACTATTAACTGATCG AAATTTAAATACCTCATTTTTCGACCCCTCAGGAGGAGGAGACCCTATTCTTTATCAACATCTATTTTGATTCTTTGGTC ACCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGATTAATTTCACATATCATTTTTAATGAAAGAGGTAAAAAGGAA ATCTTTGGTAATTTAGGTATAATTTATGCTATACTAGGAATTGGATTTTTAGGATTCATTGTTTGAGCCCATCACATATT CACAGTAGGTCTAGACGTTGATACACGAGCATATTTTACATCTGCAACAATAATTATTGCAGTACCTA
Institution Code ELKU
Collection Code ABeeBOL
Scientific name Lasioglossum (Evylaeus) metis
Japanese name Japanese String
Basis of Record Japanese String
Kingdum Animalia
Phylum Arthropoda
Class Insecta
Order Hymenoptera
Family Halictidae
Genus Lasioglossum
Species metis
Subspecies  
Scientific Name Author Ebmer, 2002
Identification By Ryuki Murao
Year Identified 2013
Type Status  
Collector Ryuki Murao
Collecting Date 13/06/2013
Country JP(JAPAN)
State Province Fukuoka
County Tagawa-gun
Locality Kyushu Univ., Hikosan Exp. Sta., Soeda-machi
Longitude 130.9154033
Latitude 33.48020722
Sex F
Preparation Type Normal
Related Catalog Item  
Specimen Depository Kyushu University
Publication  
Notes  
Image TDNA000130 sample


Publications, Manuals and Explanations

  Tadauchi, O., C. Hirosawa, H. Inoue, T. Sugimoto, R. Murao, N. Takahashi, S. Sato, K. Mitai and Y. Hara, 2009. Specimen database AIIC, Asian insect information center database, based on types and normal specimens collected in Asia and the Pacific Area, Part 1. Esakia, (49): 1-5.



Copyright Notice

Entomology Database Project Group (Head: O. Tadauchi, Editors: O. Tadauchi, R. Murao, M. Maruyama, System administrator: H. Inoue, F. Kamitomo) holds the copyright on the entomology database ABeeBOL.

When a user uses the data on the ABeeBOL and publishes the study, the recommended citation is as follows:
Murao, R. and O. Tadauchi (2013-) Entomology Database, ABeeBOL, http://konchudb.agr.agr.kyushu-u.ac.jp/abeebol/index-e.html (December 19, 2013).



Inquiries and Comments

Inquiries and Comments about ABeeBOL Should be the Following E-mail Address.

Database ABeeBOL (Osamu Tadauchi)
Entomological Laboratory,
Faculty of Agriculture,
Kyushu University
Fukuoka, 812-8581
Japan
E-mail: tadauchi@kyudai.jp


Link